Быстрый заказ

Text Size:AAA

Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat MGC109340 Информация о продукте «Клон cDNA»
Размер кДНК:543bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus similar to Microsomal signal peptidase 23 kDa subunit (SPase 22 kDa subunit) (SPC22/23) with N terminal Flag tag.
Синоним гена:Spcs3
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81332-ACGRBS15396
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81332-ACRRBS15400
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81332-ANGRBS15396
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81332-ANRRBS15400
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81332-CFRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81332-CHRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81332-CMRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81332-CYRBS13343
Крыса MGC109340 Джин клон кДНК в вектор клонированияRG81332-GRBS5132
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81332-NFRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81332-NHRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81332-NMRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81332-NYRBS13343
Крыса MGC109340 Джин ORF экспрессии кДНК клона плазмидыRG81332-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81332-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.