After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat MGAT3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019239.2
Размер кДНК:1617bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase with N terminal HA tag.
Синоним гена:MGAT3
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80436-ACGRBS16764
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80436-ACRRBS16764
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80436-CFRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80436-CHRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80436-CMRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80436-CYRBS14711
Крыса MGAT3 Джин клон кДНК в вектор клонированияRG80436-GRBS5132
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80436-NFRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80436-NHRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80436-NMRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80436-NYRBS14711
Крыса MGAT3 Джин ORF экспрессии кДНК клона плазмидыRG80436-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80436-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».