Быстрый заказ

Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса MFAP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001107989.1
    Размер кДНК:558bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus microfibrillar-associated protein 2 with N terminal Myc tag.
    Синоним гена:Mfap2
    Виды:Rat
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MFAP2 qPCR primers for gene expression analysis, RP300711 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80747-ACGRBS15400
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80747-ACRRBS15400
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80747-CFRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80747-CHRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80747-CMRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80747-CYRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80747-NFRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80747-NHRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80747-NMRBS13340
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80747-NYRBS13340
    Крыса MFAP2 Джин клон кДНК в вектор клонированияRG80747-URBS5130
    Крыса MFAP2 Джин ORF экспрессии кДНК клона плазмидыRG80747-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80747-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».