Быстрый заказ

Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LY6E Информация о продукте «Клон cDNA»
Размер кДНК:411bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lymphocyte antigen 6 complex, locus E with N terminal HA tag.
Синоним гена:Ly6e
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80502-ACGRBS15400
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80502-ACRRBS15400
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80502-CFRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80502-CHRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80502-CMRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80502-CYRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80502-NFRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80502-NHRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80502-NMRBS13340
Крыса LY6E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80502-NYRBS13340
Крыса LY6E Джин клон кДНК в вектор клонированияRG80502-URBS5130
Крыса LY6E Джин ORF экспрессии кДНК клона плазмидыRG80502-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80502-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.