Быстрый заказ

Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LTBR Информация о продукте «Клон cDNA»
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lymphotoxin beta receptor (TNFR superfamily, member 3) with N terminal Flag tag.
Синоним гена:MGC94657, Ltbr
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80178-ACGRBS15400
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80178-ACRRBS15400
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80178-CFRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80178-CHRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80178-CMRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80178-CYRBS13340
Крыса LTBR/TNFRSF3 Джин клон кДНК в вектор клонированияRG80178-GRBS5130
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80178-NFRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80178-NHRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80178-NMRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80178-NYRBS13340
Крыса LTBR/TNFRSF3 Джин ORF экспрессии кДНК клона плазмидыRG80178-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

LTBR (lymphotoxin beta receptor (TNFR superfamily, member 3)) is a member of the tumor necrosis factor (TNF) family of receptors. Tumor necrosis factor receptor is a trimeric cytokine receptor that binds tumor necrosis factors. The receptor cooperates with an adaptor protein (such as TRADD, TRAF, RIP), which is important in determining the outcome of the response. LTBR is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LTBR specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphtoxin-beta). LTBR and its ligand play a role in the development and organization of lymphoid tissue and tranformed cells. Activation of this protein can trigger apoptosis. Not only does the LTBR help trigger apoptosis, it can lead to the release of the cytokine interleukin 8. Overexpression of LTBR in HEK293 cells increases IL-8 promoter activity and leads to IL-8 release. It is also essential for development and organization of the secondary lymphoid organs and chemokine release.

  • Summers deLuca L, et al. (2011) A LTβR signaling in dendritic cells induces a type I IFN response that is required for optimal clonal expansion of CD8+ T cells. Proc Natl Acad Sci. 108(5):2046-51.
  • Bista P, et al. (2010) TRAF3 controls activation of the canonical and alternative NFkappaB by the lymphotoxin beta receptor. J Biol Chem. 285(17):12971-8.
  • Xu Y, et al. (2011) Adiponectin inhibits lymphotoxin-β receptor-mediated NF-κB signaling in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 404(4):1060-4.
  • Size / Price
    Каталог: RG80178-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.