Быстрый заказ

Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LTA Информация о продукте «Клон cDNA»
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lymphotoxin alpha (TNF superfamily, member 1) with N terminal Flag tag.
Синоним гена:Tnfb, Tnfsf1, Lta
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80147-ACGRBS15400
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80147-ACRRBS15400
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80147-CFRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80147-CHRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80147-CMRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80147-CYRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин клон кДНК в вектор клонированияRG80147-GRBS5130
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80147-NFRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80147-NHRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80147-NMRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80147-NYRBS13340
Крыса TNF-beta/TNFSF1/Lymphotoxin alpha Джин ORF экспрессии кДНК клона плазмидыRG80147-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • Size / Price
    Каталог: RG80147-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.