Быстрый заказ

Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса LRFN3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001107502.1
Размер кДНК:1881bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus leucine rich repeat and fibronectin type III domain containing 3 with C terminal His tag.
Синоним гена:Lrfn3
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LRFN3 qPCR primers for gene expression analysis, RP300253 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80272-ACGRBS16760
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80272-ACRRBS16760
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80272-CFRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80272-CHRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80272-CMRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80272-CYRBS14710
Крыса LRFN3 Джин клон кДНК в вектор клонированияRG80272-GRBS5130
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80272-NFRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80272-NHRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80272-NMRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80272-NYRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмидыRG80272-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80272-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».