After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LRFN3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001107502.1
Размер кДНК:1881bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus leucine rich repeat and fibronectin type III domain containing 3 with C terminal His tag.
Синоним гена:Lrfn3
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80272-ACGRBS16760
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80272-ACRRBS16760
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80272-CFRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80272-CHRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80272-CMRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80272-CYRBS14710
Крыса LRFN3 Джин клон кДНК в вектор клонированияRG80272-GRBS5130
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80272-NFRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80272-NHRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80272-NMRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80272-NYRBS14710
Крыса LRFN3 Джин ORF экспрессии кДНК клона плазмидыRG80272-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80272-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».