Быстрый заказ

Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса LMAN2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001115024.2
    Размер кДНК:1077bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus lectin, mannose-binding 2.
    Синоним гена:Vip36
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LMAN2 qPCR primers for gene expression analysis, RP300986 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81022-ACGRBS15400
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81022-ACRRBS15400
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81022-CFRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81022-CHRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81022-CMRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81022-CYRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81022-NFRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81022-NHRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81022-NMRBS13340
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81022-NYRBS13340
    Крыса LMAN2 Джин клон кДНК в вектор клонированияRG81022-URBS5130
    Крыса LMAN2 Джин ORF экспрессии кДНК клона плазмидыRG81022-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Ссылки
  • Nawa D, et al. (2007) Stable interaction of the cargo receptor VIP36 with molecular chaperone BiP. Glycobiology. 17(9): 913-21.
  • Shimada O, et al. (2003) Localization of VIP36 in the post-Golgi secretory pathway also of rat parotid acinar cells. J Histochem Cytochem. 51(8): 1057-63.
  • Hara-Kuge S, et al. (1999) Vesicular-integral membrane protein, VIP36, recognizes high-mannose type glycans containing alpha1--2 mannosyl residues in MDCK cells. Glycobiology. 9(8): 833-9.
  • Fullekrug J, et al. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci. 112 ( Pt 17): 2813-21.
  • Size / Price
    Каталог: RG81022-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».