After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Rat LMAN2 natural ORF mammalian expression plasmid

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LMAN2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001115024.2
Размер кДНК:1077bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lectin, mannose-binding 2.
Синоним гена:Vip36
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Ссылки
  • Nawa D, et al. (2007) Stable interaction of the cargo receptor VIP36 with molecular chaperone BiP. Glycobiology. 17(9): 913-21.
  • Shimada O, et al. (2003) Localization of VIP36 in the post-Golgi secretory pathway also of rat parotid acinar cells. J Histochem Cytochem. 51(8): 1057-63.
  • Hara-Kuge S, et al. (1999) Vesicular-integral membrane protein, VIP36, recognizes high-mannose type glycans containing alpha1--2 mannosyl residues in MDCK cells. Glycobiology. 9(8): 833-9.
  • Fullekrug J, et al. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci. 112 ( Pt 17): 2813-21.
  • Size / Price
    Каталог: RG81022-UT
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие2-3 weeks
     Инструкции по доставке
    Изображения
        Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».