Быстрый заказ

Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса LILRA5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001076793.1
    Размер кДНК:888bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 with N terminal His tag.
    Синоним гена:Lilrc1, Lilra5
    Виды:Rat
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LILRA5 qPCR primers for gene expression analysis, RP300304 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80334-ACGRBS15400
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80334-ACRRBS15400
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80334-CFRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80334-CHRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80334-CMRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80334-CYRBS13340
    Крыса LILRA5 Джин клон кДНК в вектор клонированияRG80334-GRBS5130
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80334-NFRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80334-NHRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80334-NMRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80334-NYRBS13340
    Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмидыRG80334-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

    Ссылки
  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».