Быстрый заказ

Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LILRA5 Информация о продукте «Клон cDNA»
Размер кДНК:888bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 with N terminal His tag.
Синоним гена:Lilrc1, Lilra5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80334-ACGRBS15400
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80334-ACRRBS15400
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80334-CFRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80334-CHRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80334-CMRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80334-CYRBS13340
Крыса LILRA5 Джин клон кДНК в вектор клонированияRG80334-GRBS5130
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80334-NFRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80334-NHRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80334-NMRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80334-NYRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмидыRG80334-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • Size / Price
    Каталог: RG80334-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.