Быстрый заказ

Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса LILRA5 Информация о продукте «Клон cDNA»
Размер кДНК:888bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 with C terminal HA tag.
Синоним гена:Lilrc1, Lilra5
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
( We provide with LILRA5 qPCR primers for gene expression analysis, RP300304 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80334-ACGRBS15400
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80334-ACRRBS15400
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80334-CFRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80334-CHRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80334-CMRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80334-CYRBS13340
Крыса LILRA5 Джин клон кДНК в вектор клонированияRG80334-GRBS5130
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80334-NFRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80334-NHRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80334-NMRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80334-NYRBS13340
Крыса LILRA5 Джин ORF экспрессии кДНК клона плазмидыRG80334-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • Size / Price
    Каталог: RG80334-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.