Быстрый заказ

Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса LIFR Информация о продукте «Клон cDNA»
    Размер кДНК:3282bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus leukemia inhibitory factor receptor alpha with C terminal His tag.
    Синоним гена:Lifr
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with LIFR qPCR primers for gene expression analysis, RP300293 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80322-ACGRBS22240
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80322-ACRRBS22240
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80322-CFRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80322-CHRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80322-CMRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80322-CYRBS20190
    Крыса LIFR/CD118 Джин клон кДНК в вектор клонированияRG80322-GRBS5130
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80322-NFRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80322-NHRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80322-NMRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80322-NYRBS20190
    Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмидыRG80322-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.