After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LIFR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031048.1
Размер кДНК:3282bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus leukemia inhibitory factor receptor alpha with C terminal HA tag.
Синоним гена:Lifr
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80322-ACGRBS22240
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80322-ACRRBS22240
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80322-CFRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80322-CHRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80322-CMRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80322-CYRBS20190
Крыса LIFR/CD118 Джин клон кДНК в вектор клонированияRG80322-GRBS5130
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80322-NFRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80322-NHRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80322-NMRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80322-NYRBS20190
Крыса LIFR/CD118 Джин ORF экспрессии кДНК клона плазмидыRG80322-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

Ссылки
  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • Size / Price
    Каталог: RG80322-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».