After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LGALS4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012975.1
Размер кДНК:975bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 4.
Синоним гена:L-36, L36LBI, Lgals4
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80253-ACGRBS15400
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80253-ACRRBS15400
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80253-ANGRBS15400
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80253-ANRRBS15400
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80253-CFRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80253-CHRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80253-CMRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80253-CYRBS13340
Крыса Galectin-4/LGALS4 Джин клон кДНК в вектор клонированияRG80253-GRBS5130
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80253-NFRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80253-NHRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80253-NMRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80253-NYRBS13340
Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмидыRG80253-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80253-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».