Быстрый заказ

Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса LGALS4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_012975.1
    Размер кДНК:975bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 4.
    Синоним гена:L-36, L36LBI, Lgals4
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGALS4 qPCR primers for gene expression analysis, RP300238 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80253-ACGRBS15400
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80253-ACRRBS15400
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80253-ANGRBS15400
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80253-ANRRBS15400
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80253-CFRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80253-CHRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80253-CMRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80253-CYRBS13340
    Крыса Galectin-4/LGALS4 Джин клон кДНК в вектор клонированияRG80253-GRBS5130
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80253-NFRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80253-NHRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80253-NMRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80253-NYRBS13340
    Крыса Galectin-4/LGALS4 Джин ORF экспрессии кДНК клона плазмидыRG80253-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80253-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».