After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LGALS1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019904.1
Размер кДНК:408bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 1.
Синоним гена:Lgals1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80248-ACGRBS15400
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80248-ACRRBS15400
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80248-CFRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80248-CHRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80248-CMRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80248-CYRBS13340
Крыса Galectin-1/LGALS1 Джин клон кДНК в вектор клонированияRG80248-GRBS5130
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80248-NFRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80248-NHRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80248-NMRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80248-NYRBS13340
Крыса Galectin-1/LGALS1 Джин ORF экспрессии кДНК клона плазмидыRG80248-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.

Ссылки
  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
  • Size / Price
    Каталог: RG80248-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».