Быстрый заказ

Text Size:AAA

Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LAYN Информация о продукте «Клон cDNA»
Размер кДНК:1131bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus layilin with N terminal HA tag.
Синоним гена:RGD1564444, Layn
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80431-ACGRBS15400
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80431-ACRRBS15400
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80431-CFRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80431-CHRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80431-CMRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80431-CYRBS13340
Крыса Layilin / LAYN Джин клон кДНК в вектор клонированияRG80431-GRBS5130
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80431-NFRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80431-NHRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80431-NMRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80431-NYRBS13340
Крыса Layilin / LAYN Джин ORF экспрессии кДНК клона плазмидыRG80431-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Layilin, a recently characterized as a 55 kDa transmembrane protein with homology to C-type lectins, is present in numerous cell lines and tissue extracts. As one of the adaptor proteins, talin mediates the interactions between the actin filaments and the cell membrane by binding to integral membrane proteins and to the cytoskeleton. Layilin is a newly identified membrane-binding site for talin in peripheral ruffles of spreading cells, a ten-amino acid motif in the layilin cytoplasmic domain is sufficient for talin binding, and its adjacent LH2-LH3 tandem arrays in the cytoplasmic domain provide docking sites for talin. Furthermore, talin binds layilin, PIPK1gamma and integrins in similar although subtly different ways. Layilin binds specifically to hyaluronan (HA) through its extracellular domain, a ubiquitous extracellular matrix component in most animal tissues and body fluids, but not to other tested glycosaminoglycans. The research suggests that layilin may mediate signals from extracellular matrix to the cell cytoskeleton via interaction with different intracellular binding partners and thereby be involved in the modulation of cortical structures in the cell. All the above actions reveal an interesting parallel between layilin and the known HA receptor CD44. In addition, merlin and radixin have been identified as different intracellular binding partners of layilin. Accordingly, it has been suggested that layilin plays roles in a variety of cellular processes, including cell shape, adhesion, motility, and homeostasis, as well as signal transduction. In addition, layilin might play an important role in the process of invasion and lymphatic metastasis of lung carcinoma.

  • Borowsky ML, et al. (1998) Layilin, a novel talin-binding transmembrane protein homologous with C-type lectins, is localized in membrane ruffles.J Cell Biol. 143(2):429-42.
  • Bono P, et al. (2001) Layilin, a novel integral membrane protein, is a hyaluronan receptor. Mol Biol Cell. 12(4)891-900.
  • Bono P, et al. (2005) Layilin, a cell surface hyaluronan receptor, interacts with merlin and radixin. Exp Cell Res. 308(1):177-87.
  • Scoles DR. (2007) The merlin interacting proteins reveal multiple targets for NF2 therapy. Biochim Biophys Acta. 1785(1):32-54.
  • Chen Z, et al. (2008) Down-regulation of layilin, a novel hyaluronan receptor, via RNA interference, inhibits invasion and lymphatic metastasis of human lung A549 cells. Biotechnol Appl Biochem. 50(Pt 2):89-96.
  • Wegener KL, et al. (2008) Structural basis for the interaction between the cytoplasmic domain of the hyaluronate receptor layilin and the talin F3 subdomain. J Mol Biol. 382(1):112-26.
  • Size / Price
    Каталог: RG80431-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.