Быстрый заказ

Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса LAMP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_017068.2
    Размер кДНК:1236bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus lysosomal-associated membrane protein 2 with C terminal HA tag.
    Синоним гена:Lamp2
    Виды:Rat
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LAMP2 qPCR primers for gene expression analysis, RP300393 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80368-ACGRBS15400
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80368-ACRRBS15400
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80368-CFRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80368-CHRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80368-CMRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80368-CYRBS13340
    Крыса LAMP2/CD107b Джин клон кДНК в вектор клонированияRG80368-GRBS5130
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80368-NFRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80368-NHRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80368-NMRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80368-NYRBS13340
    Крыса LAMP2/CD107b Джин ORF экспрессии кДНК клона плазмидыRG80368-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    LAMP2 (Lysosomal-associated membrane protein 2), also known as CD107b (Cluster of Differentiation 107b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.

    Ссылки
  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
  • Size / Price
    Каталог: RG80368-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».