Быстрый заказ

Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat LAG3 Информация о продукте «Клон cDNA»
Размер кДНК:1578bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus lymphocyte-activation gene 3 with C terminal HA tag.
Синоним гена:CD223, MGC108901, Lag3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80367-ACGRBS16760
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80367-ACRRBS16760
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80367-CFRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80367-CHRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80367-CMRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80367-CYRBS14710
Крыса LAG3/LAG-3/CD223 Джин клон кДНК в вектор клонированияRG80367-GRBS5130
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80367-NFRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80367-NHRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80367-NMRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80367-NYRBS14710
Крыса LAG3/LAG-3/CD223 Джин ORF экспрессии кДНК клона плазмидыRG80367-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

LAG3, also known as CD223 and Lymphocyte activation gene 3, belongs to immunoglobulin (Ig) superfamily. LAG3 contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. It is selectively expressed in activated T and NK cells. LAG3 has a negative regulatory function in T cells. It also acts as as a new marker of T cell induced B cell activation. As a soluble molecule, LAG3 activates antigen-presenting cells through MHC class II signalling, leading to increased antigen-specific T-cell responses in vivo.

  • Sigrid Hannier. et al., 1998, The Journal of Immunology. 161(8): 4058-65.
  • Triebel F. et al., 1990, J Exp Med. 171 (5): 1393-405.
  • Baixeras E. et al., 1992, J Exp Med. 176 (2): 327-37.
  • Huard B. et al., 1997, Proc Natl Acad Sci. 94 (11): 5744-9.
  • Kisielow M. et al., 2005, Eur J Immunol. 35 (7): 2081-8.
  • Size / Price
    Каталог: RG80367-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.