After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat KPRP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001002290.1
Размер кДНК:2100bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus keratinocyte proline-rich protein.
Синоним гена:Kprp
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81011-ACGRBS16760
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81011-ACRRBS16760
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81011-ANGRBS16760
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81011-ANRRBS16760
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81011-CFRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81011-CHRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81011-CMRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81011-CYRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81011-NFRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81011-NHRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81011-NMRBS14710
Крыса KPRP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81011-NYRBS14710
Крыса KPRP Джин клон кДНК в вектор клонированияRG81011-URBS5130
Крыса KPRP Джин ORF экспрессии кДНК клона плазмидыRG81011-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81011-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».