Быстрый заказ

Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat KNG2 Информация о продукте «Клон cDNA»
Размер кДНК:1920bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus kininogen 2 with C terminal His tag.
Синоним гена:Kng1, Kngk, KINKG, KINKH
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81650-ACGRBS16760
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81650-ACRRBS16760
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81650-CFRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81650-CHRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81650-CMRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81650-CYRBS14710
Крыса KNG2 Джин клон кДНК в вектор клонированияRG81650-GRBS5130
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81650-NFRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81650-NHRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81650-NMRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81650-NYRBS14710
Крыса KNG2 Джин ORF экспрессии кДНК клона плазмидыRG81650-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81650-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.