After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat KLRK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133512.1
Размер кДНК:648bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus killer cell lectin-like receptor subfamily K, member 1.
Синоним гена:NKG2D, Nkrp2, Klrk1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80250-ACGRBS15400
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80250-ACRRBS15400
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80250-CFRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80250-CHRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80250-CMRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80250-CYRBS13340
Крыса NKG2D/CD314/KLRK1 Джин клон кДНК в вектор клонированияRG80250-GRBS5130
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80250-NFRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80250-NHRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80250-NMRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80250-NYRBS13340
Крыса NKG2D/CD314/KLRK1 Джин ORF экспрессии кДНК клона плазмидыRG80250-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NKG2D, also known as CD314, is an immune receptor which consists of two disulphide-linked type II transmembrane proteins with short intracellular proteins uncapable to transduce signals. In order to transduce signals, NKG2D needs adaptor proteins and it uses two adaptor proteins, DAP10 and DAP12. These two adaptor proteins associate as homodimers to NKG2D- therefore the entire receptor complex appears as a hexamer. NKG2D can send co-stimulatory signals to activate CD8 T cells. NKG2D also plays an important role in viral control. Cellular stress can induce ligands for NKG2D which results in the cell susceptible to NK cell-mediated lysis.

Ссылки
  • Houchins J, et al. (1991) DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. J Exp Med. 173: 1017-102.
  • Bauer S, et al. (1999) Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science. 285(5428):727-9.
  • Zafirova B, et al. (2011) Regulation of immune cell function and differentiation by the NKG2D receptor. Cell Mol Life Sci. 68(21):3519-29.
  • Size / Price
    Каталог: RG80250-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».