Быстрый заказ

Text Size:AAA

Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat KLRD1 Информация о продукте «Клон cDNA»
Размер кДНК:540bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus killer cell lectin-like receptor, subfamily D, member 1 with N terminal His tag.
Синоним гена:Cd94, Klrd1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80301-ACGRBS15396
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80301-ACRRBS15396
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80301-CFRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80301-CHRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80301-CMRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80301-CYRBS13343
Крыса CD94/KLRD1 Джин клон кДНК в вектор клонированияRG80301-GRBS5132
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80301-NFRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80301-NHRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80301-NMRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80301-NYRBS13343
Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмидыRG80301-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80301-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.