Быстрый заказ

Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса KLRD1 Информация о продукте «Клон cDNA»
    Размер кДНК:540bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus killer cell lectin-like receptor, subfamily D, member 1 with C terminal His tag.
    Синоним гена:Cd94, Klrd1
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with KLRD1 qPCR primers for gene expression analysis, RP300277 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80301-ACGRBS15400
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80301-ACRRBS15400
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80301-CFRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80301-CHRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80301-CMRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80301-CYRBS13340
    Крыса CD94/KLRD1 Джин клон кДНК в вектор клонированияRG80301-GRBS5130
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80301-NFRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80301-NHRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80301-NMRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80301-NYRBS13340
    Крыса CD94/KLRD1 Джин ORF экспрессии кДНК клона плазмидыRG80301-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80301-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.