Быстрый заказ

Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса KIT Информация о продукте «Клон cDNA»
    Размер кДНК:2937bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog with N terminal His tag.
    Синоним гена:Kit
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with KIT qPCR primers for gene expression analysis, RP300292 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80321-ACGRBS22240
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80321-ACRRBS22240
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80321-CFRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80321-CHRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80321-CMRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80321-CYRBS20190
    Крыса KIT / c-KIT / CD117 Джин клон кДНК в вектор клонированияRG80321-GRBS5130
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80321-NFRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80321-NHRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80321-NMRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80321-NYRBS20190
    Крыса KIT / c-KIT / CD117 Джин ORF экспрессии кДНК клона плазмидыRG80321-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). c-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains.and 1 protein kinase domain. It belongs to the protein kinase superfamily, tyr protein kinase family and CSF-1/PDGF receptor subfamily. C-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains and 1 protein kinase domain. C-Kit has a tyrosine-protein kinase activity. Binding of the ligands leads to the autophosphorylation of KIT and its association with substrates such as phosphatidylinositol 3-kinase. Antibodies to c-Kit are widely used in immunohistochemistry to help distinguish particular types of tumour in histological tissue sections. It is used primarily in the diagnosis of GISTs. In GISTs, c-Kit staining is typically cytoplasmic, with stronger accentuation along the cell membranes. C-Kit antibodies can also be used in the diagnosis of mast cell tumours and in distinguishing seminomas from embryonal carcinomas. Mutations in c-Kit gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Defects in KIT are a cause of acute myelogenous leukemia (AML). AML is a malignant disease in which hematopoietic precursors are arrested in an early stage of development. Note=Somatic mutations that lead to constitutive activation of KIT are detected in AML patients.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Andre C, et al. (1997) Sequence analysis of two genomic regions containing the KIT and the FMS receptor tyrosine kinase genes. Genomics. 39(2):216-26.
  • Yarden Y, et al. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 6(11):3341-51.
  • Leong KG, et al. (2008) Generation of a prostate from a single adult stem cell. Nature. 456(7223): 804-8.
  • Edling CE, et al. (2007) c-Kit--a hematopoietic cell essential receptor tyrosine kinase. Int J Biochem Cell Biol. 39(11):1995-8.
  • McIntyre A, et al. (2005) Amplification and overexpression of the KIT gene is associated with progression in the seminoma subtype of testicular germ cell tumors of adolescents and adults. Cancer Res. 65(18):8085-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.