Быстрый заказ

Text Size:AAA

Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IZUMO4 Информация о продукте «Клон cDNA»
Размер кДНК:684bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus IZUMO family member 4 with N terminal Flag tag.
Синоним гена:RGD1564722
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81606-ACGRBS15400
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81606-ACRRBS15400
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81606-CFRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81606-CHRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81606-CMRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81606-CYRBS13340
Крыса IZUMO4 Джин клон кДНК в вектор клонированияRG81606-GRBS5130
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81606-NFRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81606-NHRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81606-NMRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81606-NYRBS13340
Крыса IZUMO4 Джин ORF экспрессии кДНК клона плазмидыRG81606-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Co-immunoprecipitation studies showed the presence of other sperm proteins associated with Izumo 1, suggesting Izumo 1 forms a multiprotein membrane complex.

  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ellerman DA, et al. (2009) Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm. Mol Reprod Dev. 76(12):1188-99.
  • Size / Price
    Каталог: RG81606-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.