Integrin beta 1 cDNA ORF Clone, Rat, N-His tag

Price:
Size:
Number:

Integrin beta 1 cDNA ORF Clone, Rat, N-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2397 bp
Description
Full length Clone DNA of Rat integrin, beta 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Integrin beta 1 Background Information

ITGB1 is a heterodimeric cell-surface receptor involved in cell functions such as proliferation, migration, invasion and survival.Integrin beta1 (ITGB1) has been recognized to play a major role in tumor growth, invasion and metastasis.Using luciferase assays, we identified integrin beta1 (ITGB1) as a direct target of miR-134.ITGB1 is a direct target of miR-493-5p suggesting that ITGB1 and miR-493-5p may have potential prognostic value and may be useful as tumor biomarkers for the diagnosis of NSCLC patients.
Full Name
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Research Areas

Integrin beta 1 cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait