Быстрый заказ

Text Size:AAA

Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ITGB1 Информация о продукте «Клон cDNA»
Размер кДНК:2397bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, beta 1 with N terminal His tag.
Синоним гена:Itgb1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80290-ACGRBS16764
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80290-ACRRBS16764
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80290-CFRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80290-CHRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80290-CMRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80290-CYRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин клон кДНК в вектор клонированияRG80290-GRBS5132
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80290-NFRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80290-NHRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80290-NMRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80290-NYRBS14711
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмидыRG80290-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80290-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.