Быстрый заказ

Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса ITGB1 Информация о продукте «Клон cDNA»
Размер кДНК:2397bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, beta 1 with C terminal His tag.
Синоним гена:Itgb1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
( We provide with ITGB1 qPCR primers for gene expression analysis, RP300267 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80290-ACGRBS16760
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80290-ACRRBS16760
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80290-CFRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80290-CHRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80290-CMRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80290-CYRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин клон кДНК в вектор клонированияRG80290-GRBS5130
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80290-NFRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80290-NHRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80290-NMRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80290-NYRBS14710
Крыса ITGB1 / Integrin beta-1 / CD29 Джин ORF экспрессии кДНК клона плазмидыRG80290-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.