Быстрый заказ

Крыса Integrin alpha V/CD51/ITGAV Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ITGAV Информация о продукте «Клон cDNA»
Размер кДНК:1506bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, alpha V with N terminal His tag.
Синоним гена:Cd51, Itgav
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.