After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ITGA6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_006234351.1
Размер кДНК:3273bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, alpha 6 with N terminal His tag.
Синоним гена:Itga6
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80292-ACGRBS22238
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80292-ACRRBS22238
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80292-CFRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80292-CHRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80292-CMRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80292-CYRBS20185
Крыса Integrin alpha 6/ITGA6 Джин клон кДНК в вектор клонированияRG80292-GRBS5132
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80292-NFRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80292-NHRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80292-NMRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80292-NYRBS20185
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмидыRG80292-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80292-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».