After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ITGA6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_006234351.1
Размер кДНК:3273bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, alpha 6 with C terminal His tag.
Синоним гена:Itga6
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80292-ACGRBS22240
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80292-ACRRBS22240
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80292-CFRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80292-CHRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80292-CMRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80292-CYRBS20190
Крыса Integrin alpha 6/ITGA6 Джин клон кДНК в вектор клонированияRG80292-GRBS5130
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80292-NFRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80292-NHRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80292-NMRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80292-NYRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмидыRG80292-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80292-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».