Быстрый заказ

Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ITGA6 Информация о продукте «Клон cDNA»
Размер кДНК:3273bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, alpha 6 with C terminal His tag.
Синоним гена:Itga6
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80292-ACGRBS22240
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80292-ACRRBS22240
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80292-CFRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80292-CHRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80292-CMRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80292-CYRBS20190
Крыса Integrin alpha 6/ITGA6 Джин клон кДНК в вектор клонированияRG80292-GRBS5130
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80292-NFRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80292-NHRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80292-NMRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80292-NYRBS20190
Крыса Integrin alpha 6/ITGA6 Джин ORF экспрессии кДНК клона плазмидыRG80292-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80292-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.