Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-His tag

Price:
Size:
Number:

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3111 bp
Description
Full length Clone DNA of Rat integrin, alpha 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Integrin alpha 4/CD49d/ITGA4 Background Information

Full Name
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Research Areas
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait