Быстрый заказ

Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса ITGA3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001108292.1
    Размер кДНК:1926bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, alpha 3 with C terminal His tag.
    Синоним гена:Itga3
    Виды:Rat
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ITGA3 qPCR primers for gene expression analysis, RP300284 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80310-ACGRBS16760
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80310-ACRRBS16760
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80310-CFRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80310-CHRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80310-CMRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80310-CYRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин клон кДНК в вектор клонированияRG80310-GRBS5130
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80310-NFRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80310-NHRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80310-NMRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80310-NYRBS14710
    Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмидыRG80310-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80310-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».