Быстрый заказ

Text Size:AAA

Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ITGA3 Информация о продукте «Клон cDNA»
Размер кДНК:1926bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus integrin, alpha 3 with C terminal HA tag.
Синоним гена:Itga3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80310-ACGRBS16760
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80310-ACRRBS16760
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80310-CFRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80310-CHRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80310-CMRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80310-CYRBS14710
Крыса Integrin alpha 3/ITGA3 Джин клон кДНК в вектор клонированияRG80310-GRBS5130
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80310-NFRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80310-NHRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80310-NMRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80310-NYRBS14710
Крыса Integrin alpha 3/ITGA3 Джин ORF экспрессии кДНК клона плазмидыRG80310-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.