Быстрый заказ

Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL7 Информация о продукте «Клон cDNA»
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 7 with C terminal HA tag.
Синоним гена:Il1a, IL-1alpha
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80329-ACGRBS15396
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80329-ACRRBS15396
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80329-CFRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80329-CHRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80329-CMRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80329-CYRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин клон кДНК в вектор клонированияRG80329-GRBS5132
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80329-NFRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80329-NHRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80329-NMRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80329-NYRBS13343
Крыса IL7/IL-7/Interleukin-7 Джин ORF экспрессии кДНК клона плазмидыRG80329-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • Size / Price
    Каталог: RG80329-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.