After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021834.1
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 24 with N terminal HA tag.
Синоним гена:B-cell growth factor II, BCGF-II, IL-5
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80458-ACGRBS15400
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80458-ACRRBS15400
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80458-CFRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80458-CHRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80458-CMRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80458-CYRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин клон кДНК в вектор клонированияRG80458-GRBS5130
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80458-NFRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80458-NHRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80458-NMRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80458-NYRBS13340
Крыса IL-5/IL5 / Interleukin 5 Джин ORF экспрессии кДНК клона плазмидыRG80458-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

Ссылки
  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • Size / Price
    Каталог: RG80458-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».