Быстрый заказ

Text Size:AAA

Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL4R Информация о продукте «Клон cDNA»
Размер кДНК:2406bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 4 receptor, alpha with N terminal Flag tag.
Синоним гена:Il4ra, Il4r
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80198-ACGRBS16760
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80198-ACRRBS16760
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80198-CFRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80198-CHRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80198-CMRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80198-CYRBS14710
Крыса IL-4R/CD124 Джин клон кДНК в вектор клонированияRG80198-GRBS5130
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80198-NFRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80198-NHRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80198-NMRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80198-NYRBS14710
Крыса IL-4R/CD124 Джин ORF экспрессии кДНК клона плазмидыRG80198-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD124, also known as interleukin 4 receptor (IL4R), is a typeⅠ transmembrane protein that can regulate IgE antibody production in B cells through binding to interleukin 4 and interleukin 13 and promote differentiation of Th2 cells through binding to interleukin 4. The membrane-bound form of CD124 can be hydrolyzed to soluble form which can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Size / Price
    Каталог: RG80198-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.