After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_201270.1
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 4.
Синоним гена:Il4e12, Il4
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:pCMV3-ratIL4
Участок рестрикции:KpnI + XbaI (6.1kb + 0.44kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Rat IL4 Gene Plasmid Map
Rat IL4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80236-ACGRBS15400
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80236-ACRRBS15400
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80236-CFRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80236-CHRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80236-CMRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80236-CYRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин клон кДНК в вектор клонированияRG80236-GRBS5130
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80236-NFRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80236-NHRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80236-NMRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80236-NYRBS13340
Крыса IL4/IL-4/Interleukin-4 Джин ORF экспрессии кДНК клона плазмидыRG80236-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.

Ссылки
  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.
  • Size / Price
    Каталог: RG80236-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Rat IL4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».