Быстрый заказ

Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL2RG Информация о продукте «Клон cDNA»
Размер кДНК:1107bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 2 receptor, gamma with N terminal Flag tag.
Синоним гена:Cd132, Ab2-183, Il2rg
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80197-ACGRBS15400
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80197-ACRRBS15400
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80197-CFRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80197-CHRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80197-CMRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80197-CYRBS13340
Крыса CD132 / IL2RG Джин клон кДНК в вектор клонированияRG80197-GRBS5130
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80197-G-FRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80197-NFRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80197-NHRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80197-NMRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80197-NYRBS13340
Крыса CD132 / IL2RG Джин ORF экспрессии кДНК клона плазмидыRG80197-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
  • Size / Price
    Каталог: RG80197-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.