Быстрый заказ

Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL2RB Информация о продукте «Клон cDNA»
Размер кДНК:1614bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 2 receptor, beta with C terminal HA tag.
Синоним гена:IL2RBC, Il2rb
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80340-ACGRBS16760
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80340-ACRRBS16760
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80340-CFRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80340-CHRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80340-CMRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80340-CYRBS14710
Крыса CD122 / IL-2RB Джин клон кДНК в вектор клонированияRG80340-GRBS5130
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80340-NFRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80340-NHRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80340-NMRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80340-NYRBS14710
Крыса CD122 / IL-2RB Джин ORF экспрессии кДНК клона плазмидыRG80340-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Size / Price
    Каталог: RG80340-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.