After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL27 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_344962.4
Размер кДНК:705bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 27 with N terminal Flag tag.
Синоним гена:RGD1561420, Il27
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80201-ACGRBS15400
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80201-ACRRBS15400
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80201-CFRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80201-CHRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80201-CMRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80201-CYRBS13340
Крыса IL-27 Джин клон кДНК в вектор клонированияRG80201-GRBS5130
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80201-NFRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80201-NHRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80201-NMRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80201-NYRBS13340
Крыса IL-27 Джин ORF экспрессии кДНК клона плазмидыRG80201-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p40-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.

Ссылки
  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
  • Size / Price
    Каталог: RG80201-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».