Быстрый заказ

Text Size:AAA

Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL25 Информация о продукте «Клон cDNA»
Размер кДНК:510bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 25 with N terminal Flag tag.
Синоним гена:RGD1561632, Il25
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80194-ACGRBS15400
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80194-ACRRBS15400
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80194-CFRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80194-CHRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80194-CMRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80194-CYRBS13340
Крыса IL-17E/IL-25 Джин клон кДНК в вектор клонированияRG80194-GRBS5130
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80194-NFRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80194-NHRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80194-NMRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80194-NYRBS13340
Крыса IL-17E/IL-25 Джин ORF экспрессии кДНК клона плазмидыRG80194-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. IL-25 is a member of the IL-17 family of cytokines. However, unlike the other members of this family, IL-25 promotes T helper (Th) 2 responses. IL-25 also regulates the development of autoimmune inflammation mediated by IL-17–producing T cells. IL-25 and IL-17, being members of the same cytokine family, play opposing roles in the pathogenesis of organ-specific autoimmunity. IL-25 promotes cell expansion and Th2 cytokine production when Th2 central memory cells are stimulated with thymic stromal lymphopoietin (TSLP)–activated dendritic cells (DCs), homeostatic cytokines, or T cell receptor for antigen triggering. Elevated expression of IL-25 and IL-25R transcripts was observed in asthmatic lung tissues and atopic dermatitis skin lesions, linking their possible roles with exacerbated allergic disorders. A plausible explanation that IL-25 produced by innate effector eosinophils and basophils may augment the allergic inflammation by enhancing the maintenance and functions of adaptive Th2 memory cells had been provided.

  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Tamachi T, et al.. (2006) IL-25 enhances allergic airway inflammation by amplifying a TH2 cell-dependent pathway in mice. J Allergy Clin Immunol. 118(3): 606-14.
  • Kleinschek MA, et al.. (2007) IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 204(1): 161-70.
  • Size / Price
    Каталог: RG80194-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.