Быстрый заказ

Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL22RA2 Информация о продукте «Клон cDNA»
Размер кДНК:690bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 22 receptor, alpha 2 with N terminal Flag tag.
Синоним гена:Crf2-s1, Il22ra2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80203-ACGRBS15400
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80203-ACRRBS15400
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80203-CFRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80203-CHRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80203-CMRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80203-CYRBS13340
Крыса IL-22BP/IL-22RA2 Джин клон кДНК в вектор клонированияRG80203-GRBS5130
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80203-NFRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80203-NHRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80203-NMRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80203-NYRBS13340
Крыса IL-22BP/IL-22RA2 Джин ORF экспрессии кДНК клона плазмидыRG80203-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-22 receptor subunit alpha-2 (IL-22RA2), also known as interleukin-22-binding protein (IL-22BP), is a subunit of the receptor for interleukin 22. IL-22BP belongs to the type I I cytokine receptor family and contains 3 fibronectin type-III domains. IL-22BP/IL-22RA2 is expressed in a range of tissues, including those in the digestive, female reproductive, and immune systems. It is expressed in placenta, spleen, breast, skin and lung. It is also detected in intestinal tract, testis, brain, heart and thymus. The dominant cell types expressing IL-22BP/IL-22RA2 were mononuclear cells and epithelium. IL-22BP/IL-22RA2 may play an important role as an IL-22 antagonist in the regulation of inflammatory responses. Interleukin-22 (IL-22) is a member of IL-10 family. It is produced by T cells and induces the production of acute-phase reactants. IL-22 plays important roles in immune response through activation of the STAT 3 signal transduction pathway. Two types of IL-22-binding receptor have been discovered, a membrane-bound receptor and a soluble receptor.

  • Whittington HA, et al. (2004) Interleukin-22: a potential immunomodulatory molecule in the lung. Am J Respir Cell Mol Biol. 31(2): 220-6.
  • Dumoutier L, et al. (2001) Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J Immunol. 166(12): 7090-5.
  • Wei CC, et al. (2003) Cloning and characterization of mouse IL-22 binding protein. Genes Immun. 4(3): 204-11.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.