IL22RA1 cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

IL22RA1 cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1734 bp
Description
Full length Clone DNA of Rat interleukin22receptor,alpha1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL22RA1 Background Information

IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed in colon, liver, lung, pancreas and kidney. IL-22R also can be expressed in keratinocytes of normal skin as well as in psoriatic skin lesion. Overexpression of IL-22R can be detected in synovial fluid cells from rheumatoid arthritis and spondyloarthropathy patients. IL-22R is a component of the receptor for IL2, IL22 and IL24. The component of IL-22R formed by IL22RA1 and IL1RB enables IL22 signaling via JAK/STAT pathways. IL22 also induces activation of MAPK1/MAPK3 and Akt kinases pathways. Component of one of the receptor for IL2 and IL24 formed by IL22RA1 and IL2RB also signaling through STATs activation. IL-22R mediates IL24 antiangiogenic activity as well as IL24 inhibitory effect on endothelial cell tube formation and differentiation.
Full Name
interleukin 22 receptor, alpha 1
References
  • Xie MH, et al. (2000) Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. 275(40):31335-9.
  • Xu W, et al. (2001) A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc Natl Acad Sci. 98(17):9511-6.
  • Wu PW, et al. (2008) IL-22R, IL-10R2, and IL-22BP binding sites are topologically juxtaposed on adjacent and overlapping surfaces of IL-22. J Mol Biol. 382(5):1168-83.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait