Быстрый заказ

Rat IL22RA1 ORF mammalian expression plasmid, N-HA tag

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL22RA1 Информация о продукте «Клон cDNA»
Размер кДНК:1734bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin22receptor,alpha1 with N terminal HA tag.
Синоним гена:RGD1559655, Il22ra1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.


IL-22R belongs to the type II cytokine receptor family. It contains 2 fibronectin type-III domains and is expressed in colon, liver, lung, pancreas and kidney. IL-22R also can be expressed in keratinocytes of normal skin as well as in psoriatic skin lesion. Overexpression of IL-22R can be detected in synovial fluid cells from rheumatoid arthritis and spondyloarthropathy patients. IL-22R is a component of the receptor for IL20, IL22 and IL24. The component of IL-22R formed by IL22RA1 and IL10RB enables IL22 signaling via JAK/STAT pathways. IL22 also induces activation of MAPK1/MAPK3 and Akt kinases pathways. Component of one of the receptor for IL20 and IL24 formed by IL22RA1 and IL20RB also signaling through STATs activation. IL-22R mediates IL24 antiangiogenic activity as well as IL24 inhibitory effect on endothelial cell tube formation and differentiation.

  • Xie MH, et al. (2000) Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J Biol Chem. 275(40):31335-9.
  • Xu W, et al. (2001) A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc Natl Acad Sci. 98(17):9511-6.
  • Wu PW, et al. (2008) IL-22R, IL-10R2, and IL-22BP binding sites are topologically juxtaposed on adjacent and overlapping surfaces of IL-22. J Mol Biol. 382(5):1168-83.
  • Size / Price
    Каталог: RG80453-NY
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие2-3 weeksИнструкции по доставке
        Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.