Быстрый заказ

Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL22 Информация о продукте «Клон cDNA»
Размер кДНК:540bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 22 with N terminal HA tag.
Синоним гена:RGD1561292
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80463-ACGRBS15400
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80463-ACRRBS15400
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80463-CFRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80463-CHRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80463-CMRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80463-CYRBS13340
Крыса IL22 / Interleukin 22 Джин клон кДНК в вектор клонированияRG80463-GRBS5130
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80463-NFRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80463-NHRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80463-NMRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80463-NYRBS13340
Крыса IL22 / Interleukin 22 Джин ORF экспрессии кДНК клона плазмидыRG80463-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL22 is a member of a group of cytokines called the IL-10 family or IL-10 superfamily (including IL-19, IL-20, IL-24, and IL-26),  a class of potent mediators of cellular inflammatory responses. It shares use of IL-10R2 in cell signaling with other members of this family, IL-10, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems.

IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-10 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S100s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-10. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.

  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
  • Size / Price
    Каталог: RG80463-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.