After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL20RB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001173438.1
Размер кДНК:927bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 20 receptor beta with N terminal Flag tag.
Синоним гена:IL20R2, RGD1566151, Il20rb
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80187-ACGRBS15400
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80187-ACRRBS15400
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80187-CFRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80187-CHRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80187-CMRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80187-CYRBS13340
Крыса IL20RB Джин клон кДНК в вектор клонированияRG80187-GRBS5130
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80187-NFRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80187-NHRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80187-NMRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80187-NYRBS13340
Крыса IL20RB Джин ORF экспрессии кДНК клона плазмидыRG80187-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

Ссылки
  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.
  • Size / Price
    Каталог: RG80187-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».