Быстрый заказ

Text Size:AAA

Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL1R2 Информация о продукте «Клон cDNA»
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 1 receptor, type II with N terminal Flag tag.
Синоним гена:Il-1r2, Il1rb, Il1r2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80196-ACGRBS15400
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80196-ACRRBS15400
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80196-CFRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80196-CHRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80196-CMRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80196-CYRBS13340
Крыса IL-1R2/CD121b Джин клон кДНК в вектор клонированияRG80196-GRBS5130
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80196-NFRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80196-NHRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80196-NMRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80196-NYRBS13340
Крыса IL-1R2/CD121b Джин ORF экспрессии кДНК клона плазмидыRG80196-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

  • Cannon JG, et al. (1997) Interleukin-1 beta, interleukin-1 receptor antagonist, and soluble interleukin-1 receptor type II secretion in chronic fatigue syndrome. J Clin Immunol. 17 (3): 253-61.
  • Liu C, et al. (1996) Cloning and characterization of an alternatively processed human type II interleukin-1 receptor mRNA. J Biol Chem. 271 (34): 20965-72.
  • Van der Poll T, et al. (1997) Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis. 175 (1): 118-22.
  • Size / Price
    Каталог: RG80196-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.