Быстрый заказ

Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL17RB Информация о продукте «Клон cDNA»
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 17 receptor B with N terminal Flag tag.
Синоним гена:Il17rb, Il17rb_predicted
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80188-ACGRBS15400
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80188-ACRRBS15400
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80188-CFRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80188-CHRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80188-CMRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80188-CYRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин клон кДНК в вектор клонированияRG80188-GRBS5130
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80188-NFRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80188-NHRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80188-NMRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80188-NYRBS13340
Крыса IL17BR / IL17RB / IL-17 Receptor B Джин ORF экспрессии кДНК клона плазмидыRG80188-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    Каталог: RG80188-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.