Быстрый заказ

Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL17RA Информация о продукте «Клон cDNA»
Размер кДНК:2607bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 17 receptor A with N terminal Flag tag.
Синоним гена:Il17r, Il17ra
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80190-ACGRBS22240
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80190-ACRRBS22240
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80190-CFRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80190-CHRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80190-CMRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80190-CYRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин клон кДНК в вектор клонированияRG80190-GRBS5130
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80190-NFRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80190-NHRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80190-NMRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80190-NYRBS20190
Крыса IL17RA/IL-17RA/CD217 Джин ORF экспрессии кДНК клона плазмидыRG80190-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-17 receptor (IL-17R), also known as Interleukin-17 receptor A (IL-17RA) and CD217 antigen (CD217), is a cytokine receptor which binds interleukin 17. IL-17R/IL-17RA (CD217) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. IL-17R/IL-17RA (CD217) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor IL-17RA play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Defects in IL-17R/IL-17RA (CD217) are the cause of familial candidiasis type 5 (CANDF5). CANDF5 is a rare disorder with altered immune responses and impaired clearance of fungal infections, selective against Candida. It is characterized by persistent and/or recurrent infections of the skin, nails and mucous membranes caused by organisms of the genus Candida, mainly Candida albicans.

  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9 (8): 556-67.
  • Johansen C, et al.. (2009) Characterization of the interleukin-17 isoforms and receptors in lesional psoriatic skin. Br J Dermatol. 160 (2): 319-24.
  • Yao Z, et al.. (1997) Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine 9 (11): 794-800.
  • Size / Price
    Каталог: RG80190-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.