Быстрый заказ

Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса IL17B Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_053789.1
    Размер кДНК:543bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 17B with N terminal Flag tag.
    Синоним гена:Il17b
    Виды:Rat
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL17B qPCR primers for gene expression analysis, RP300163 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80170-ACGRBS15400
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80170-ACRRBS15400
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80170-CFRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80170-CHRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80170-CMRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80170-CYRBS13340
    Крыса IL17B/ZCYTO7 Джин клон кДНК в вектор клонированияRG80170-GRBS5130
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80170-NFRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80170-NHRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80170-NMRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80170-NYRBS13340
    Крыса IL17B/ZCYTO7 Джин ORF экспрессии кДНК клона плазмидыRG80170-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80170-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».